86
|
Thermo Fisher
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag/product/Thermo Fisher Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
90
|
Qiagen
forward and reverse primers Forward And Reverse Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Qiagen Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Biomics Biotechnologies
forward and reverse primers Forward And Reverse Primers, supplied by Biomics Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Biomics Biotechnologies Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Midland Certified Reagent
forward and reverse primers Forward And Reverse Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/Midland Certified Reagent Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
oligo (dt) primer and m-mlv reverse transcriptase Oligo (Dt) Primer And M Mlv Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oligo (dt) primer and m-mlv reverse transcriptase/product/Promega Average 90 stars, based on 1 article reviews
oligo (dt) primer and m-mlv reverse transcriptase - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
GeneWorks
forward and reverse primers Forward And Reverse Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/forward and reverse primers/product/GeneWorks Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
stem-loop reverse transcript primer and m-mlv reverse transcriptase Stem Loop Reverse Transcript Primer And M Mlv Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/stem-loop reverse transcript primer and m-mlv reverse transcriptase/product/Promega Average 90 stars, based on 1 article reviews
stem-loop reverse transcript primer and m-mlv reverse transcriptase - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Eurofins Genomics
primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc Primer: Thrap3 I2 Reverse: Caagcagaagacggcatacgagatacatcg Attggcctggttcggtcttctc, supplied by Eurofins Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc/product/Eurofins Genomics Average 90 stars, based on 1 article reviews
primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Pacific Biosciences
the primer pair encodes forward and reverse barcodes for amplicon sequencing The Primer Pair Encodes Forward And Reverse Barcodes For Amplicon Sequencing, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/the primer pair encodes forward and reverse barcodes for amplicon sequencing/product/Pacific Biosciences Average 90 stars, based on 1 article reviews
the primer pair encodes forward and reverse barcodes for amplicon sequencing - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Metabion International AG
mouse primers Mouse Primers, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mouse primers/product/Metabion International AG Average 90 stars, based on 1 article reviews
mouse primers - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Biolegio bv
barcoded forward primer and reverse primer mix biolegio bv Barcoded Forward Primer And Reverse Primer Mix Biolegio Bv, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/barcoded forward primer and reverse primer mix biolegio bv/product/Biolegio bv Average 90 stars, based on 1 article reviews
barcoded forward primer and reverse primer mix biolegio bv - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Promega
moloney murine leukemia virus reverse transcriptase primed with oligo(dt) 15 primer Moloney Murine Leukemia Virus Reverse Transcriptase Primed With Oligo(Dt) 15 Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/moloney murine leukemia virus reverse transcriptase primed with oligo(dt) 15 primer/product/Promega Average 90 stars, based on 1 article reviews
moloney murine leukemia virus reverse transcriptase primed with oligo(dt) 15 primer - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |