forward and reverse primers Search Results


86
Thermo Fisher forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag
Forward Primer Reverse Primer Probe Kcnq1 Rs12296050 Gtgcttagactgtgcccg Gggagaccctgtctcgaa Ctcctgggctcctaacctttcacag, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
forward primer reverse primer probe kcnq1 rs12296050 gtgcttagactgtgcccg gggagaccctgtctcgaa ctcctgggctcctaacctttcacag - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

90
Qiagen forward and reverse primers
Forward And Reverse Primers, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Qiagen
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Biomics Biotechnologies forward and reverse primers
Forward And Reverse Primers, supplied by Biomics Biotechnologies, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Biomics Biotechnologies
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Midland Certified Reagent forward and reverse primers
Forward And Reverse Primers, supplied by Midland Certified Reagent, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/Midland Certified Reagent
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega oligo (dt) primer and m-mlv reverse transcriptase
Oligo (Dt) Primer And M Mlv Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligo (dt) primer and m-mlv reverse transcriptase/product/Promega
Average 90 stars, based on 1 article reviews
oligo (dt) primer and m-mlv reverse transcriptase - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
GeneWorks forward and reverse primers
Forward And Reverse Primers, supplied by GeneWorks, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/forward and reverse primers/product/GeneWorks
Average 90 stars, based on 1 article reviews
forward and reverse primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega stem-loop reverse transcript primer and m-mlv reverse transcriptase
Stem Loop Reverse Transcript Primer And M Mlv Reverse Transcriptase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/stem-loop reverse transcript primer and m-mlv reverse transcriptase/product/Promega
Average 90 stars, based on 1 article reviews
stem-loop reverse transcript primer and m-mlv reverse transcriptase - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Eurofins Genomics primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc
Primer: Thrap3 I2 Reverse: Caagcagaagacggcatacgagatacatcg Attggcctggttcggtcttctc, supplied by Eurofins Genomics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc/product/Eurofins Genomics
Average 90 stars, based on 1 article reviews
primer: thrap3_i2 reverse: caagcagaagacggcatacgagatacatcg attggcctggttcggtcttctc - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Pacific Biosciences the primer pair encodes forward and reverse barcodes for amplicon sequencing
The Primer Pair Encodes Forward And Reverse Barcodes For Amplicon Sequencing, supplied by Pacific Biosciences, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/the primer pair encodes forward and reverse barcodes for amplicon sequencing/product/Pacific Biosciences
Average 90 stars, based on 1 article reviews
the primer pair encodes forward and reverse barcodes for amplicon sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Metabion International AG mouse primers
Mouse Primers, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse primers/product/Metabion International AG
Average 90 stars, based on 1 article reviews
mouse primers - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Biolegio bv barcoded forward primer and reverse primer mix biolegio bv
Barcoded Forward Primer And Reverse Primer Mix Biolegio Bv, supplied by Biolegio bv, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/barcoded forward primer and reverse primer mix biolegio bv/product/Biolegio bv
Average 90 stars, based on 1 article reviews
barcoded forward primer and reverse primer mix biolegio bv - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Promega moloney murine leukemia virus reverse transcriptase primed with oligo(dt) 15 primer
Moloney Murine Leukemia Virus Reverse Transcriptase Primed With Oligo(Dt) 15 Primer, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/moloney murine leukemia virus reverse transcriptase primed with oligo(dt) 15 primer/product/Promega
Average 90 stars, based on 1 article reviews
moloney murine leukemia virus reverse transcriptase primed with oligo(dt) 15 primer - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results